Citation Context

... originally identified as a contaminant of a cell line (Tischer et al., 1974). PCV1 infection in swine is not pathogenic and is widespread, as reported in a number of serological surveys (reviewed by =-=Allan & Ellis, 2000-=-). In France, the first PMWS outbreaks were described in 1996 (Madec et al., 2000). From 1999 onwards, the incidence of the disease regressed in response to improvements in rearing practices. At the t...

Citation Context

...tbreaks in Brittany are most likely not due to the emergence of a new genotype of circovirus. INTRODUCTION Post-weaning multisystemic wasting syndrome (PMWS) was initially described in North America (=-=Clark, 1997-=-; Harding, 1997) and subsequently observed in most pigproducing countries of Europe (LeCann et al., 1997; Segales et al., 1997; Allan et al., 1998, 1999a; Kiss et al., 2000; Wellenberg et al., 2000; S...

Citation Context

... is poorly understood, since PCV2 infection of pigs does not necessarily lead to PMWS. Indeed, experimental inoculations of pigs with pure PCV2 only reproduced mild PMWS symptoms (Magar et al., 2000; =-=Fenaux et al., 2002-=-), and serological evidence of PCV2 infection has been found in diseased as well as in healthy herds (Blanchard et al., 2003). Furthermore, various viral co-infections (Allan et al., 1999b; Ellis et a...

Citation Context

... al., 2000; Fenaux et al., 2002), and serological evidence of PCV2 infection has been found in diseased as well as in healthy herds (Blanchard et al., 2003). Furthermore, various viral co-infections (=-=Allan et al., 1999-=-b; Ellis et al., 2000; Rovira et al., 2002) and environmental and management factors (Madec et al., 2000; Labarque et al., 2000; Rose et al., 2003) have been shown to be involved in PMWS. The PCV2 gen...

Citation Context

...ORF1 Table 2. Sequences of the PCR and sequencing primers Primer positions are indicated relatively to a reference strain (GenBank accession no. AF201311) and numbered from the origin of replication (=-=Hamel et al., 1998-=-). Position (nt) Sequence (5§R3§) PCR PF2 610–629 TTGCTGAGCCTAGCGACACC PR2 955–936 TCCACTGCTTCAAATCGGCC CF8 1322–1341 TAGGTTAGGGCTGTGGCCTT CR8 1585–1566 CCGCACCTTCGGATATACTG 64CA2* 1536–1555 AGGAGGGCG...

Citation Context

...ues appear to be the most typical lesions. The disease affects pigs in both post-weaning and fattening units. A sporadic incidence within pig units is also reported as characteristic of the syndrome (=-=Segales & Domingo, 2002-=-). Porcine circovirus type 2 (PCV2), a member of the Circoviridae family, is now recognized as a major aetiological agent of PMWS (Allan et al., 2002; Pogranichniy et al., 2002; Rodriguez-Arrioja et a...

Citation Context

...health states have been characterized; all viral genomes shared a high nucleotide identity (range 95–100%). No molecular marker associated with a particular disease condition has yet been identified (=-=Fenaux et al., 2000-=-; Choi et al., 2002; Larochelle et al., 2002; Pogranichniy et al., 2002). The present study aimed to draw up an inventory of the PCV1 and PCV2 sequences isolated in Brittany during the PMWS outbreaks....

Citation Context

...ittany are most likely not due to the emergence of a new genotype of circovirus. INTRODUCTION Post-weaning multisystemic wasting syndrome (PMWS) was initially described in North America (Clark, 1997; =-=Harding, 1997-=-) and subsequently observed in most pigproducing countries of Europe (LeCann et al., 1997; Segales et al., 1997; Allan et al., 1998, 1999a; Kiss et al., 2000; Wellenberg et al., 2000; Saoulidis et al....

Citation Context

...lar, molecular evidence suggests that the domestication of the pig occurred 9000 years ago, and there was a massive introduction of Asian pigs into European breeds during the 18th and 19th centuries (=-=Giuffra et al., 2000-=-). All studies, including the present one, converge on the conclusion that the PMWS epidemics do not originate in the appearance of a new PCV2 variant. In addition, the very high prevalence of PCV2 am...

Citation Context

...ological evidence of PCV2 infection has been found in diseased as well as in healthy herds (Blanchard et al., 2003). Furthermore, various viral co-infections (Allan et al., 1999b; Ellis et al., 2000; =-=Rovira et al., 2002-=-) and environmental and management factors (Madec et al., 2000; Labarque et al., 2000; Rose et al., 2003) have been shown to be involved in PMWS. The PCV2 genome is a circular single-stranded DNA mole...

Citation Context

...epresent 93% of the genome. PCV2 is highly related to, yet distinct from, the first reported swine circovirus, Porcine circovirus type 1 (PCV1), originally identified as a contaminant of a cell line (=-=Tischer et al., 1974-=-). PCV1 infection in swine is not pathogenic and is widespread, as reported in a number of serological surveys (reviewed by Allan & Ellis, 2000). In France, the first PMWS outbreaks were described in ...

Citation Context

...using a DNeasy Tissue kit (Qiagen), according to the manufacturer’s instructions. In the first PCR step, specific PCV1 and PCV2 sequences were detected using two sets of previously described primers (=-=Larochelle et al., 1999-=-): PF2/PR2, specific for a 349 bp fragment located in the ORF1 of PCV1, and CF8/CR8, specific for a 263 bp fragment in the ORF2 of PCV2. A high-fidelity DNA polymerase (DyNAzyme EXT DNA Polymerase; Oz...

Citation Context

... in the pathogenesis is poorly understood, since PCV2 infection of pigs does not necessarily lead to PMWS. Indeed, experimental inoculations of pigs with pure PCV2 only reproduced mild PMWS symptoms (=-=Magar et al., 2000-=-; Fenaux et al., 2002), and serological evidence of PCV2 infection has been found in diseased as well as in healthy herds (Blanchard et al., 2003). Furthermore, various viral co-infections (Allan et a...

Citation Context

... observed in most pigproducing countries of Europe (LeCann et al., 1997; Segales et al., 1997; Allan et al., 1998, 1999a; Kiss et al., 2000; Wellenberg et al., 2000; Saoulidis et al., 2002) and Asia (=-=Kiupel et al., 1998-=-; Onuki et al., 1999; Choi et al., 2000). PMWS is clinically characterized by weight loss, respiratory or digestive disorders and enlarged lymph nodes. Lymphocyte depletion and histiocytic infiltratio...

Citation Context

...teristic of the syndrome (Segales & Domingo, 2002). Porcine circovirus type 2 (PCV2), a member of the Circoviridae family, is now recognized as a major aetiological agent of PMWS (Allan et al., 2002; =-=Pogranichniy et al., 2002-=-; Rodriguez-Arrioja et al., 2002). However, its precise role in the pathogenesis is poorly understood, since PCV2 infection of pigs does not necessarily lead to PMWS. Indeed, experimental inoculations...

Citation Context

...egales & Domingo, 2002). Porcine circovirus type 2 (PCV2), a member of the Circoviridae family, is now recognized as a major aetiological agent of PMWS (Allan et al., 2002; Pogranichniy et al., 2002; =-=Rodriguez-Arrioja et al., 2002-=-). However, its precise role in the pathogenesis is poorly understood, since PCV2 infection of pigs does not necessarily lead to PMWS. Indeed, experimental inoculations of pigs with pure PCV2 only rep...

Citation Context

..., 2000), but, interestingly, PCV1 was no longer detected in any sample in the present study. This result confirms the general very low PCV1 incidence (3–5%) reported by others (Mankertz et al., 2000; =-=Calsamiglia et al., 2002-=-). In addition, it strengthens the assumption by Calsamiglia et al. (2002) that the seroprevalence of PCV1 may have been overestimated in previous serological studies due to epitopes common to both PC...

Citation Context

...en characterized; all viral genomes shared a high nucleotide identity (range 95–100%). No molecular marker associated with a particular disease condition has yet been identified (Fenaux et al., 2000; =-=Choi et al., 2002-=-; Larochelle et al., 2002; Pogranichniy et al., 2002). The present study aimed to draw up an inventory of the PCV1 and PCV2 sequences isolated in Brittany during the PMWS outbreaks. In addition, we fo...

Citation Context

...y herds (Blanchard et al., 2003). Furthermore, various viral co-infections (Allan et al., 1999b; Ellis et al., 2000; Rovira et al., 2002) and environmental and management factors (Madec et al., 2000; =-=Labarque et al., 2000-=-; Rose et al., 2003) have been shown to be involved in PMWS. The PCV2 genome is a circular single-stranded DNA molecule of about 1?77 kb. The two main viral genes, ORF1 (replication-associated, rep) a...

Citation Context

...trikingly high considering the large range of their geographical origins and the general prevalence of the virus. In contrast, TTV and TTV-like viruses exhibit a much greater variability (reviewed by =-=Simmonds, 2002-=-). Within this narrow frame of PCV2 diversity, the variants from France, except Fh17, still form a distinct lineage with inter-isolate identities greater than 98%. This indicates that these variants a...

Citation Context

...ng multisystemic wasting syndrome (PMWS) was initially described in North America (Clark, 1997; Harding, 1997) and subsequently observed in most pigproducing countries of Europe (LeCann et al., 1997; =-=Segales et al., 1997-=-; Allan et al., 1998, 1999a; Kiss et al., 2000; Wellenberg et al., 2000; Saoulidis et al., 2002) and Asia (Kiupel et al., 1998; Onuki et al., 1999; Choi et al., 2000). PMWS is clinically characterized...

Citation Context

...ng syndrome (PMWS) was initially described in North America (Clark, 1997; Harding, 1997) and subsequently observed in most pigproducing countries of Europe (LeCann et al., 1997; Segales et al., 1997; =-=Allan et al., 1998-=-, 1999a; Kiss et al., 2000; Wellenberg et al., 2000; Saoulidis et al., 2002) and Asia (Kiupel et al., 1998; Onuki et al., 1999; Choi et al., 2000). PMWS is clinically characterized by weight loss, res...

Citation Context

...entified in the cap gene (ORF2) induced amino acid substitutions, some of which were non-conservative (Table 3). As a multifunctional protein, Cap plays a key role in virulence for some Circoviridae (=-=Todd et al., 2002-=-) and other DNA icosahedral Fig. 4. Similarity plots along PCV2 sequences from PMWS(+) and PMWS(”) herds. The PLOTSIMILARITY program (GCG Wisconsin package) was used to draw similarity score curves by...

Citation Context

...ially described in North America (Clark, 1997; Harding, 1997) and subsequently observed in most pigproducing countries of Europe (LeCann et al., 1997; Segales et al., 1997; Allan et al., 1998, 1999a; =-=Kiss et al., 2000-=-; Wellenberg et al., 2000; Saoulidis et al., 2002) and Asia (Kiupel et al., 1998; Onuki et al., 1999; Choi et al., 2000). PMWS is clinically characterized by weight loss, respiratory or digestive diso...

Citation Context

...TRODUCTION Post-weaning multisystemic wasting syndrome (PMWS) was initially described in North America (Clark, 1997; Harding, 1997) and subsequently observed in most pigproducing countries of Europe (=-=LeCann et al., 1997-=-; Segales et al., 1997; Allan et al., 1998, 1999a; Kiss et al., 2000; Wellenberg et al., 2000; Saoulidis et al., 2002) and Asia (Kiupel et al., 1998; Onuki et al., 1999; Choi et al., 2000). PMWS is cl...

Citation Context

...of Europe (LeCann et al., 1997; Segales et al., 1997; Allan et al., 1998, 1999a; Kiss et al., 2000; Wellenberg et al., 2000; Saoulidis et al., 2002) and Asia (Kiupel et al., 1998; Onuki et al., 1999; =-=Choi et al., 2000-=-). PMWS is clinically characterized by weight loss, respiratory or digestive disorders and enlarged lymph nodes. Lymphocyte depletion and histiocytic infiltration of lymphoid tissues appear to be the ...

Citation Context

...o reported as characteristic of the syndrome (Segales & Domingo, 2002). Porcine circovirus type 2 (PCV2), a member of the Circoviridae family, is now recognized as a major aetiological agent of PMWS (=-=Allan et al., 2002-=-; Pogranichniy et al., 2002; Rodriguez-Arrioja et al., 2002). However, its precise role in the pathogenesis is poorly understood, since PCV2 infection of pigs does not necessarily lead to PMWS. Indeed...