Citation Context

...contain mutations. To create plasmids in which expression of these genes was L-arabinose inducible, we cloned a attRflanked ccdB cat cassette into a blunt-ended EcoRI site of pBAD30, creating pCE46 =-=(36, 38)-=-. Int, Xis, and IHF were used to recombine the attL-flanked rtsA, rtsB, and rtsAB fragments into pCE46 to create the plasmids pRtsA, pRtsB, and pRtsAB (38). To create c-Myc epitope-tagged versions ...

Citation Context

..., fCj7, fCj13, fCj23, fCj28, fCj29, fCj42, fCj48, and fCj54) have been previously described (8, 32, 50). The Escherichia coli strains used were DH5aMCR (GibcoBRL Life Technologies), HB101 (5), LMG194 =-=(17)-=-, S17-1 (40), and BW19851 (28), an S17-1 pir strain. E. coli strains were grown in Luria-Bertani (LB) medium at 37°C and F. johnsoniae strains were grown in Casitone-yeast extract (CYE) medium at 30°C...

Citation Context

...cible expression vectors pBAD18 (ampicillin resistance; high copy, 100 to 300 copies/cell) or pBAD33 (chloramphenicol resistance; low copy,15 copies/cell) that had been digested with EcoRI and XbaI =-=(20)-=-. Subcloning into pBAD33 required partial digestion with EcoRI due to the presence of a second cut site in the chloramphenicol cassette. Ligation mixtures were transformed into chemically competent E....

Citation Context

...uots, and frozen at 80°C. Prior to use, penicillinase was diluted in LB broth to 50 U ml1. Persistence assays. Freshly transformed TH1273 cells carrying appropriate derivatives of the pBAD33 vector =-=(16)-=- were used for all persistence assays. Overnight cultures were diluted to an optical density at 600 nm (OD600) of 0.025 in MOPS-minimal medium supplemented with glucose, amino acids, and chloramphenic...

Citation Context

...less cloning or recombineering (6, 45). The Expand High Fidelity PCR system from Roche (Basel, Switzerland) was used for inverse PCR according to the manufacturer’s specifications. The pBAD24 plasmid =-=(19)-=- was used as template for inverse PCR along with forward primer 5�-GGTAGGAG TGAAAAGCGGGTCGTGGCCGTTGTCTCTTTCTGACGCATGAATTCC TCCTGCTAGCCCAAAAAAAC-3� and reverse primer 5�-GAAAAATACAT CAGCGACATTGACAGTTAT...

Citation Context

...eviously (13). Plasmids used in this study are described in Table 1. Plasmids pAraG18, pAraV18, and pAraGV18 were constructed by cloning EcoRI-cleaved PCR products into EcoRI- and SmaI-cleaved pBAD18 =-=(11)-=-. Primers used were AraG-Start (59 GGA ATT CAG GAG GAA ACG ATG AAG TCT TCC CAT TTT GAT 39) and AraG-Stop (59 CGC GGA TCC TTA AAT AAT TTG CCC TCG 39) to make pAraG18, AraV-Start (59 GGA ATT CAG GAG GAA...

Citation Context

...f pBAD-mazF. mazF was PCR amplified from strain MC4100 relA1 (3). The PCR fragment was cut with HindIII and XbaI and ligated to HindIII-XbaI sites of pBAD33 carrying a chloramphenicol resistance gene =-=(12)-=- (kindly provided by Larry Snyder), downstream from the araBAD promoter. Construction of pQE-�his-mazE. mazE was PCR amplified from strain MC4100 relA1 (3). The PCR fragment was cut with HindIII and E...

Citation Context

...Z ring occurs in at least two steps. Proteins FtsA and ZipA are recruited by direct interaction with FtsZ. Many of the remaining proteins do not interact directly with FtsZ, but rather depend on FtsA =-=(2, 14, 23, 32)-=-. Deletion of the min locus results in the production of minicells, small anucleate cells produced by division occurring near the poles of the cell (3). These minicell divisions appear to occur at the...