• Documents
  • Authors
  • Tables
  • Log in
  • Sign up
  • MetaCart
  • DMCA
  • Donate

CiteSeerX logo

Advanced Search Include Citations
Advanced Search Include Citations

Conditional-replication, integration, excision, and retrieval plasmid-host systems for gene structure-function studies of bacteria. (2001)

by A Haldimann, B L Wanner
Venue:J. Bacteriol.
Add To MetaCart

Tools

Sorted by:
Results 1 - 10 of 83
Next 10 →

A predicted ABC transporter, FtsEX, is needed for cell division in Escherichia coli

by Kari L. Schmidt, Nicholas D. Peterson, Ryan J. Kustusch, Mark C. Wissel, Becky Graham, Gregory J. Phillips, David S. Weiss, Kari L. Schmidt, Nicholas D. Peterson, Ryan J. Kustusch, Mark C. Wissel, Becky Graham, Gregory J. Phillips, David S. Weiss - J Bacteriol , 2004
"... These include: This article cites 39 articles, 21 of which can be accessed free at: ..."
Abstract - Cited by 20 (1 self) - Add to MetaCart
These include: This article cites 39 articles, 21 of which can be accessed free at:
(Show Context)

Citation Context

...EC1386. EC1063 and EC1065 are derivatives of MG1655 and were constructed from pDSW513 and pDSW512 using �InCh1 pSX102(Amp r ) (5). EC1116 was constructed by integrating pDSW533 into att �80 of MG1655 =-=(16)-=-. EC1116 was transduced to Tet r with P1 grown on MM61 [ftsA12(Ts) leu::Tn10] or DRC14 [ftsZ84(Ts) leu::Tn10] to create EC1152 and EC1158, respectively. EC1159 was constructed by transducing EC1116/ p...

2005. Uropathogenic Escherichia coli flagella aid in efficient urinary tract colonization

by Kelly J. Wright, Patrick C. Seed, Scott J. Hultgren
"... In the murine model of urinary tract infections (UTI), cystitis by uropathogenic Escherichia coli (UPEC) occurs through an intimate relationship with the bladder superficial umbrella cell entailing cycles of adherence, invasion, intracellular bacterial community (IBC) formation, and dispersal (fluxi ..."
Abstract - Cited by 19 (2 self) - Add to MetaCart
In the murine model of urinary tract infections (UTI), cystitis by uropathogenic Escherichia coli (UPEC) occurs through an intimate relationship with the bladder superficial umbrella cell entailing cycles of adherence, invasion, intracellular bacterial community (IBC) formation, and dispersal (fluxing) from the intracellular environment. IBC dispersal is a key step that results in the spread of bacteria over the epithelial surface to initiate additional rounds of IBC formation. We investigated the role of flagella in mediating adherence and motility during UTI, hypothesizing that the dispersion of the IBC would be incomplete in the absence of motility, thus interrupting the IBC pathway and attenuating the infection. Using gfp reporter fusions, the expression of the flagellar class I flhDC and class III fliC genes was monitored to track key points of regulation throughout the pathogenic cascade. In vitro, growth under conditions promoting motility resulted in the robust expression of both fusions. In contrast, only the class I fusion produced significant expression throughout early stages of IBC development including the dispersion stage. Thus, unlike in vitro modeling of motility, the regulatory cascade appeared incomplete in vivo. Throughout IBC formation, nonmotile �fliC mutants achieved the same number of IBCs as the wild-type (wt) strain, demonstrating that flagella are neither essential nor required for first- or second-generation IBC formation. However, in competition experiments between wt and �fliC strains, the wt was shown to have a fitness advantage in persisting throughout the urinary tract for
(Show Context)

Citation Context

...mid pCOM-GFP (6) was digested with MluI and SphI to obtain a fragment of approximately 1.1 kb containing gfp under the control of the tac promoter; this fragment was ligated into compatibly cut pAH70 =-=(15)-=- to create pAH70-COM-GFP (Table 1). This vector was subsequently electroporated into MG1655/pAH69 (15), expressing the HK022 phage integrase. Chromosomal integrants were selected on LB-kanamycin (25 �...

Role of the extracytoplasmic function protein family sigma factor RpoE in metal resistance of Escherichia coli

by Monique Egler, Cornelia Grosse, Gregor Grass, H. Nies, J. Bacteriol - J , 2005
"... This article cites 61 articles, 41 of which can be accessed free ..."
Abstract - Cited by 12 (2 self) - Add to MetaCart
This article cites 61 articles, 41 of which can be accessed free
(Show Context)

Citation Context

...NA of E. coli K-12 with primers Ec-rpoE-Pst and rseB (Ec) pASK-Pst (Table 8 in the supplemental material), cloned into plasmid pAH125, and integrated into the chromosome of strain ECA101 as described =-=(28)-=-. To construct promoter fusions with the lacZ gene, 500-bp promoter fragments of the genes rpoE (59) and cueR, cueO, and copA were amplified from total DNA of E. coli W3110 with primers Ec-rpoEp-Pst a...

The Salmonella SPI1 Type Three Secretion System Responds to

by The Rcscdb System, Dongxia Lin, Christopher V. Rao, James M. Slauch, Periplasmic Disulfide, Bond Status Flagellar, Dongxia Lin, Christopher V. Rao, James M. Slauch , 2007
"... Updated information and services can be found at: ..."
Abstract - Cited by 10 (2 self) - Add to MetaCart
Updated information and services can be found at:
(Show Context)

Citation Context

...ns were rebuilt at least once, and experiments were repeated with the independent constructs. Plasmid construction. The pAH125 lacZ reporter system is a CRIM plasmid that confers kanamycin resistance =-=(29)-=-. The replacement of the kanamycin cassette with the apramycin cassette from a related plasmid, pAE2 (W. W. Metcalf and A. C. Eliot, unpublished data), was accomplished using � Red-mediated recombinat...

CfaD-Dependent Expression of a Novel Extracytoplasmic Protein from Enterotoxigenic Escherichia coli �

by M. Carolina Pilonieta, Maria D. Bodero, George P, M. Carolina Pilonieta, Maria D. Bodero, George P. Munson , 2007
"... This article cites 34 articles, 21 of which can be accessed free ..."
Abstract - Cited by 6 (2 self) - Add to MetaCart
This article cites 34 articles, 21 of which can be accessed free
(Show Context)

Citation Context

...6 (attB HK022::pCexELac2), GPM1097 (attB HK022::pCexELac3), GPM1113 (attB HK022::pCexELac4), and GPM1114 (attB HK022::pCexELac5). Single integrants were verified by colony PCR as previously described =-=(17)-=-. Primers aat-1for (GCTGGATCCCGAGCGGCGTATAAAA) and rrsPXbaI-Rev (CGCTCTAGAAACATTTTACATAATGTAATCA) were used to amplify the cexE locus from human ETEC strains 27D (O126:nonmotile CfaD � CFA/I � STIb � ...

WW: The htx and ptx operons of Pseudomonas stutzeri WM88 are new members of the pho regulon

by Andrea K. White, William W. Metcalf, Pho Regulon, Andrea K. White, William W. Metcalf - J Bacteriol
"... This article cites 38 articles, 20 of which can be accessed free ..."
Abstract - Cited by 6 (1 self) - Add to MetaCart
This article cites 38 articles, 20 of which can be accessed free
(Show Context)

Citation Context

...BW20767 was used as a host for molecular cloning experiments. BW20767 is a tra strain that was also used as a donor for conjugations between E. coli and P. stutzeri strains. Plasmids pAH120 and pLA2 =-=(8)-=- were obtained from Barry Wanner (Purdue University, Lafayette, Ind.). * Corresponding author. Mailing address: Department of Microbiology, University of Illinois, B103 Chemical and Life Sciences Labo...

Site-specific chromosomal integration of large synthetic

by Thomas E. Kuhlman, Edward C. Cox , 2009
"... constructs ..."
Abstract - Cited by 5 (0 self) - Add to MetaCart
constructs
(Show Context)

Citation Context

...mains difficult to insert large DNA segments into the Escherichia coli chromosome. Currently, there are two main approaches to chromosomal integration: recombineering (5–11) and phage-derived methods =-=(12)-=-. Recombineering is highly effective and easy to use, involving the expression of -Red enzymes in order to promote site-specific homologous recombination between the chromosome and a small linear poly...

Repression of the inner membrane lipoprotein NlpA by Rns in enterotoxigenic Escherichia coli

by Maria D. Bodero, M. Carolina Pilonieta, George P, Maria D. Bodero, M. Carolina Pilonieta, George P. Munson - J , 2007
"... This article cites 33 articles, 21 of which can be accessed free ..."
Abstract - Cited by 5 (4 self) - Add to MetaCart
This article cites 33 articles, 21 of which can be accessed free
(Show Context)

Citation Context

...er and integration plasmid with a pir-dependent origin of replication. It was constructed by cloning a 5.5-kb BamHI-MfeI fragment from pRS550 carrying lacZYA (27) into pAH144 (accession no. AY048731) =-=(8)-=-. Transcriptional terminators flank lacZYA in the resulting plasmid. It also carries attP HK022 for Int HK022-mediated integration at attB HK022 in �pir hosts and aadA for selection with spectinomycin...

Expression Levels Influence Ribosomal Frameshifting at the Tandem

by Rare Arginine, Olga L. Gurvich, Pavel V. Baranov, Raymond F. Gestel, John F. Atkins , 2004
"... The rare codons AGG and AGA comprise 2 % and 4%, respectively, of the arginine codons of Escherichia coli K-12, and their cognate tRNAs are sparse. At tandem occurrences of either rare codon, the paucity of cognate aminoacyl tRNAs for the second codon of the pair facilitates peptidyl-tRNA shifting t ..."
Abstract - Cited by 5 (1 self) - Add to MetaCart
The rare codons AGG and AGA comprise 2 % and 4%, respectively, of the arginine codons of Escherichia coli K-12, and their cognate tRNAs are sparse. At tandem occurrences of either rare codon, the paucity of cognate aminoacyl tRNAs for the second codon of the pair facilitates peptidyl-tRNA shifting to the �1 frame. However, AGG_AGG and AGA_AGA are not underrepresented and occur 4 and 42 times, respectively, in E. coli genes. Searches for corresponding occurrences in other bacteria provide no strong support for the functional utilization of frameshifting at these sequences. All sequences tested in their native context showed 1.5 to 11% frameshifting when expressed from multicopy plasmids. A cassette with one of these sequences singly integrated into the chromosome in stringent cells gave 0.9 % frameshifting in contrast to two- to four-times-higher values obtained from multicopy plasmids in stringent cells and eight-times-higher values in relaxed cells. Thus, �1 frameshifting efficiency at AGG_AGG and AGA_AGA is influenced by the mRNA expression level. These tandem rare codons do not occur in highly expressed mRNAs. The expression of a minority of genes in probably all organisms utilizes a change in the translational reading frame at a specific site(s). The ribosomal frameshifting involved occurs at shift-prone sequences, and the proportion of ribosomes that
(Show Context)

Citation Context

...s were confirmed by DNA sequencing on automated sequencing machines (model ABI3730). Plasmid integration. The JFG001 and JFG002 integrant strains were constructed as described by Haldimann and Wanner =-=(26)-=-. Briefly, electrocompetent BW27786 cells harboring pINT-ts helper plasmid were transformed with pLA2(GST-emrK) vectors, incubated for 1hat37°C and for 30 min at 42°C, spread onto agar containing 10 �...

Stochastic activation of the response regulator PhoB by noncognate histidine kinases. J Integr Bioinform 2: 11. Supporting information Additional supporting information may be found in the online version of this article. Please note: Blackwell Publishing

by Lu Zhou, Gérald Grégori, Jennifer Masella Blackman, J. Paul Robinson, Barry L. Wanner , 2005
"... Two-component systems (TCS) are the most prevalent gene regulatory mechanism in bacteria. A typical TCS is comprised of a histidine kinase (HK) and a partner response regulator (RR). Specific environment signals lead to autophosphorylation of different HKs, which in turn act as phosphoryl donors for ..."
Abstract - Cited by 5 (1 self) - Add to MetaCart
Two-component systems (TCS) are the most prevalent gene regulatory mechanism in bacteria. A typical TCS is comprised of a histidine kinase (HK) and a partner response regulator (RR). Specific environment signals lead to autophosphorylation of different HKs, which in turn act as phosphoryl donors for autophosphorylation of their partner RRs. Nonpartner HKs and RRs also interact, giving rise to cross regulation among TCSs in response to diverse signals. PhoR (HK) and PhoB (RR) constitute the TCS for detection of environmental (extracellular) inorganic phosphate (Pi). The PhoR/PhoB TCS controls the expression of a large number of genes for acquisition of alternative phosphorus sources, including phoA, which encodes the non-specific phosphohydrolase bacterial alkaline phosphatase (Bap). Cross activation of PhoB by the nonpartner HK CreC is now a classic example of cross regulation among TCSs. A systematic search for other cross talking HKs revealed five additional HKs that activate (phosphorylate) PhoB (J. M. B. and B. L. W., unpublished data).
(Show Context)

Citation Context

...sing CRIMsplasmids [Zhou et al., 2004], which were integrated into the chromosome or a speciallysengineered low copy number F plasmid [Firth et al., 1996; Zhou et al., 2005], as describedspreviously [=-=Haldimann and Wanner, 2001-=-].sCell growth and sample preparation.sCells were routinely grown in MOPS minimal mediumswith excess Pi (2 mM K2HPO4 [Wanner, 1994]) in 16 by 150-mm tubes with 2-ml mediumscontaining 0.1% glycerol or ...

Powered by: Apache Solr
  • About CiteSeerX
  • Submit and Index Documents
  • Privacy Policy
  • Help
  • Data
  • Source
  • Contact Us

Developed at and hosted by The College of Information Sciences and Technology

© 2007-2019 The Pennsylvania State University