Results 1 -
4 of
4
Similarly
"... Abstract In developing countries, unexpected income shocks are common but informal insurance is typically incomplete. An important question is therefore whether risk-sharing within the household is e¤ective. This paper presents results from a …eld experiment with 142 married couples in Kenya in whi ..."
Abstract
- Add to MetaCart
in which individuals were given random income shocks. Even though the shocks were small relative to lifetime income, men increase private consumption when they receive the shock but not when their wives do, a rejection of e¢ ciency. Such behavior is not speci…c to the experiment -both spouses spend more
to be submitted): The Case for Young People and Nature: A Path to a Healthy Prosperous Future
- Proc. Natl. Acad. Sci
, 2012
"... Abstract. We describe scenarios that define how rapidly fossil fuel emissions must be phased down to restore Earth's energy balance and stabilize global climate. A scenario that stabilizes climate and preserves nature is technically possible and it is essential for the future of humanity. Desp ..."
Abstract
-
Cited by 1 (0 self)
- Add to MetaCart
is complicated by the fact that increasing CO 2 is only one of the factors affecting Earth's energy balance, and Earth has already partly responded to the net climate forcing by warming 0.8°C in the past century. Thus authoritative determination of the state of the climate system requires measuring
unknown title
"... Pol gene diversity of five human immunodeficiency virus type 1 subtypes: evidence for naturally occuring mutations that contribute to drug resistance, limited recombination patterns and common ancestry for subtypes B and D Cornelissen, M.T.E.; van den Burg, R.; Zorgdrager, F.K.; Lukashov, V.V.; Gou ..."
Abstract
- Add to MetaCart
with 60 l of sterile H 2 O, 10 l of the eluate was used in a reverse transcription reaction with the antisense primer 3Јhalf RT (5ЈTGACCCATCAAAAGACTTAATAGCAGAAATA, HxB2 positions 3505 to 3535). The buffers, avian myeloblastosis virus RT units, and incubation time were identical to those described
“Hi, Madam, I have a small question
"... "Hi, Madam, I have a small question." Teaching QM online: Guide to a successful cross-cultural master-course. Abstract A few years ago Centre of Development Studies at my Faculty, Faculty of Economics and Social Sciences, started an online Master's Programme in Development Management ..."
Abstract
- Add to MetaCart
to facilitate student transfers in the international educational systems, and the QM courses. I will also show the e-spaces in our Fronter system where different kinds of communication take place such as © ©2 20 00 05 5--2 20 00 09 9 Q Qu ua al li it ta at ti iv ve e S So oc ci io ol lo og gy y R Re ev vi ie ew