• Documents
  • Authors
  • Tables
  • Log in
  • Sign up
  • MetaCart
  • DMCA
  • Donate

CiteSeerX logo

Tools

Sorted by:
Try your query at:
Semantic Scholar Scholar Academic
Google Bing DBLP
Results 1 - 4 of 4

Similarly

by Pollak Lundberg , ; Wales , Haddad , ; Hoddinott , Dubois , Thomas Ligon ; Ligon , Worrall
"... Abstract In developing countries, unexpected income shocks are common but informal insurance is typically incomplete. An important question is therefore whether risk-sharing within the household is e¤ective. This paper presents results from a …eld experiment with 142 married couples in Kenya in whi ..."
Abstract - Add to MetaCart
in which individuals were given random income shocks. Even though the shocks were small relative to lifetime income, men increase private consumption when they receive the shock but not when their wives do, a rejection of e¢ ciency. Such behavior is not speci…c to the experiment -both spouses spend more

to be submitted): The Case for Young People and Nature: A Path to a Healthy Prosperous Future

by James Hansen , Pushker Kharecha , Makiko Sato , Paul Epstein , Paul J Hearty , Ove Hoegh-Guldberg , Camille Parmesan , Stefan Rahmstorf , Johan Rockstrom , Eelco J Rohling , Jeffrey Sachs , Peter Smith , Konrad Steffen , Karina Von Schuckmann , James C Zachos - Proc. Natl. Acad. Sci , 2012
"... Abstract. We describe scenarios that define how rapidly fossil fuel emissions must be phased down to restore Earth's energy balance and stabilize global climate. A scenario that stabilizes climate and preserves nature is technically possible and it is essential for the future of humanity. Desp ..."
Abstract - Cited by 1 (0 self) - Add to MetaCart
is complicated by the fact that increasing CO 2 is only one of the factors affecting Earth's energy balance, and Earth has already partly responded to the net climate forcing by warming 0.8°C in the past century. Thus authoritative determination of the state of the climate system requires measuring

unknown title

by unknown authors
"... Pol gene diversity of five human immunodeficiency virus type 1 subtypes: evidence for naturally occuring mutations that contribute to drug resistance, limited recombination patterns and common ancestry for subtypes B and D Cornelissen, M.T.E.; van den Burg, R.; Zorgdrager, F.K.; Lukashov, V.V.; Gou ..."
Abstract - Add to MetaCart
with 60 l of sterile H 2 O, 10 l of the eluate was used in a reverse transcription reaction with the antisense primer 3Јhalf RT (5ЈTGACCCATCAAAAGACTTAATAGCAGAAATA, HxB2 positions 3505 to 3535). The buffers, avian myeloblastosis virus RT units, and incubation time were identical to those described

“Hi, Madam, I have a small question

by Anne Ryen , Instnt
"... "Hi, Madam, I have a small question." Teaching QM online: Guide to a successful cross-cultural master-course. Abstract A few years ago Centre of Development Studies at my Faculty, Faculty of Economics and Social Sciences, started an online Master's Programme in Development Management ..."
Abstract - Add to MetaCart
to facilitate student transfers in the international educational systems, and the QM courses. I will also show the e-spaces in our Fronter system where different kinds of communication take place such as © ©2 20 00 05 5--2 20 00 09 9 Q Qu ua al li it ta at ti iv ve e S So oc ci io ol lo og gy y R Re ev vi ie ew
Results 1 - 4 of 4
Powered by: Apache Solr
  • About CiteSeerX
  • Submit and Index Documents
  • Privacy Policy
  • Help
  • Data
  • Source
  • Contact Us

Developed at and hosted by The College of Information Sciences and Technology

© 2007-2019 The Pennsylvania State University