Results 1 - 2 of 2

The origin of malignant malaria

by Stephen M Rich , Fabian H Leendertz , Guang Xu , Matthew Lebreton , Cyrille F Djoko , Makoah N Aminake , Eric E Takang , Joseph L D Diffo , Brian L Pike , Benjamin M Rosenthal , Pierre Formenty , Christophe Boesch , Francisco J Ayala , Nathan D Wolfe - Proceedings of the National Academy of Sciences 106 , 2009
"... Plasmodium falciparum, the causative agent of malignant malaria, is among the most severe human infectious diseases. The closest known relative of P. falciparum is a chimpanzee parasite, Plasmodium reichenowi, of which one single isolate was previously known. The co-speciation hypothesis suggests t ..."
Abstract - Cited by 10 (0 self) - Add to MetaCart
used 1 L stock DNA as template, 1ϫ PCR buffer containing 2.5 mM MgCl2, 0.2 mM dNTPs, 0.25 M of each primer, and 1.25 unit TaqDNA polymerase. PCR for cytB gene used outer primers DW2 (TAATGCCTAGACGTATTCCTGATTATCCAG) and DW3 (TGCTGTATCATAC-CCTAAAG) (6), and inter primers DW1 (TCAACAATGACTTTATTTGG

l Article

by That Blind, May See, Les Alsterlund, A Review Of Blindsight, Its Implications, Dominick Maino, For Optometrists
"... Can the blind see? Blindsight is residual visual capacity in a field defect secondary to damaged striate cortex without conscious awareness. This phenomenon was discovered when patients with this form of field loss were given forced-choice testing. Although the subjects denied seeing anything, their ..."
Abstract - Add to MetaCart
visually impaired and even man agement of our sighted patients. Key Words: blindsight, residual vision, ambient vision, consciousness, awareness. he k~ v1' tb m hi te as th sil th be fOJ so to tel ri~ so. ge Vo Can the blind see? The possibility that a blind person can see is counter-intuitive. How
Results 1 - 2 of 2