MetaCart Sign in to MyCiteSeerX

Documents
Authors
Tables !

Searching for "Of Mice and Models." – sorted by Relevance.

Order by: Citations | Year (Descending) | Year (Ascending) | Recency

Try your query at: Scholar | Yahoo! | Ask | Bing | CSB

21 documents found, showing 1 through 10. Next 10 →

ATOM

Nicotinic Acetylcholine Receptor Knockout Mice as Animal Models for Studying Receptor Function
by Lisa M. Marubio, Jean-pierre Changeux — 2000
… acetylcholine receptor knockout mice as animal models for studying receptor function Abstract Lisa M. Marubio…
Cited by 1 (1 self) – Add To MetaCart

A Novel Approach to Determine Normal Variation in Gene Expression Data
by Vinay Nadimpally, Mohammed J. Zaki
… similarity among the mice models and within the replicates. These studies help in the design of gene…
Cited by 1 (0 self) – Add To MetaCart

Oncology, Departments of Medicine
by Jessica L. Pollock, Andrew A. Lane, Kelly Schrimpf, Timothy J. Ley, Siteman Cancer
…-specific immune clearance of APL cells does occur in mice. In this model system, the relevant immunogenic antigens…
Add To MetaCart

Individual
by Karl W Broman, Chiasmata Crossovers, Meiotic Products, Chiasma Chiasmata
…’s formula The count-location model The gamma model and the ¡ Data: humans and mice ¢ model Mitosis…
Add To MetaCart

Concordance between rats and mice in bioassays for carcinogenesis
by David A. Freedman, Lois S. Gold, Tony H. Lin — 1996
…; the subscripts m and r stand for mice and rats,respectively. In this model,by assumption,all “chemicals…
Cited by 1 (0 self) – Add To MetaCart

Neyman and Stochastic Models
by L. Lecam
… yield, but may increase it for young mice. The model can fit these observations at least qualitatively…
Cited by 1 (0 self) – Add To MetaCart

Cancer Cell International CCANCER
by Biomed Central, Claudia Carrasco-legleu, Edgar Rangel-lopez, Blanca Segura-pacheco, Myrna C, Gustavo Cabrera, Alfonso Duenas-gonzalez — 2006
… xenograft model in nu/nu mice. Animals were treated with adriamycin by the intraperitoneal route with a dose…
Add To MetaCart

A High-Throughput Study of Gene Expression in Preterm Labor . . .
by Rebecca A. Muhle, A Paul Pavlidis, B William N. Grundy, Emmet Hirsch, Mda New York
… TGCCAGGTGCACCCGACTTT Table II. Treatment of mice Group Labor model Treatment No. Average time to delivery A Infection…
Add To MetaCart

Dynamic Load Balancing in Parallel Discrete Event Simulation for Spatially Explicit Problems
by Ewa Deelman Boleslaw, Boleslaw K. Szymanski — 1998 — In PADS’98, 12th Workshop on Parallel and Distributed Simulation
… disease involve humans, the main infection cycle consists of ticks and mice. We model Lyme disease…
Add To MetaCart

Dynamic Load Balancing in Parallel Discrete Event Simulation for
by Spatially Explicit Problems, Ewa Deelman, Boleslaw K. Szymanski — 1998 — In PADS’98, 12th Workshop on Parallel and Distributed Simulation
… cycle consists of ticks and mice. We model Lyme disease at the ecological level-- at the level…
Add To MetaCart

Showing 1 through 10. Next 10 →

ATOM

Try your query at: Scholar | Yahoo! | Ask | MS Live | CSB